| My Articles | Article Settings | Browse Articles |
Browse Aricles
Category: All Articles
>> Animals
Toxinotyping and Genotyping of C.perfringens Associated with Diarrhoea in Calves
Toxinotyping and Genotyping of C.perfringens Associated with Diarrhoea in Calves
Ammar, A.M.*; Mona, A. Maghwery**; Norhan, A. Khairy* and Hanaa, A. Ahmed***
*Bacteriology, Mycology and Immunology Department, Fac. of Vet. Med., Zagazig University.
**Anaerobic Unit, Bacteriology Research Department, Animal Health Research Institute, Dokki, Giza.
***Biotechnology Research Department, Animal Health Research Institute, Dokki, Giza.
ABSTRACT
In the present work, 175 faecal samples were collected from diarrhoeic calves and identified in relation to different seasons, ages and Governorates. Higher incidence of C.perfringens was in winter (83.87%), newborn diarrhoeic calves (66.67%) and in El-dakahlya Governorate (71.43%). The recorded isolates were subjected to biochemical tests (catalase, sugar fermentation, gelatin liquefaction, litmus milk and indole tests), Nagler`s test, dermonecrotic reactions in albino guinea pigs which proved that all the recorded isolates were C.perfringens types A, D and non toxigenic, toxin antitoxin neutralization test and lethal toxicity test. Conventional Polymerase chain reaction (PCR) confirmed the presence of alpha toxin gene in C.perfringens type A that gave specific amplicone at 1167 bp and alpha and epsilon toxin genes in C.perfringens type D which gave characteristic bands at 1167 and 960 bp respectively. Multiplex PCR was applied on six untypable C.perfringens isolates which were identified as C.perfringens type A by the presence of alpha toxin gene amplicone at 402 bp. Sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) of C. perfringens type A whole membrane proteins confirmed the results by the presence of 3 characteristic protein bands with molecular masses of 21.99, 29 and 59 kDa.
INTRODUCTION
Clostridium is large Gram-positive rod, mostly motile, spore forming, fermentative and catalase negative. It is widely distributed in soil and presents as normal commensals in gastrointestinal tracts of many animal species and man (Brynestad and Granum, 2002). The species of Clostridium perfringens are divided into five types from A to E on the bases of production of four major toxins namely alpha (α), beta (β), epsilon (ε) and iota (ι) (Songer, 1996 and Petit et al., 1999). Alpha toxin is the principle lethal toxin of C. perfringens and acts as phospholipase C (plc) that hydrolyze lecithin into phosphoryl-choline and diglyceride which is a major factor responsible for the organism`s pathogenicity (Awad et al., 1995). Beta toxin is a highly trypsin sensitive protein that produced mainly by C. perfringens types B and C (McDonel, 1986). Epsilon toxin is a protease activated protoxin that produced mainly by C. perfringens types B and D (Cole, 1995). Iota toxin is a binary dermonecrotic toxin that consists of iota a (Ia) and iota b (Ib)components, it is produced mainly by C.perfringens type E (Stiles and Wilkins, 1986).
The outcome of this work is determination of the incidence of C.perfringens in diarrhoeic calves in different seasons, ages and Governorates and to assess the value of using biotechnology in rapid detection of C. perfringens toxins comparing with the traditional microbiological methods.
MATERIAL AND METHODS
I- Sampling: a total of 175faecal samples were collected from diarrhoeic calves with different ages (42, 87, 46 faecal samples were collected from newly born, 1-6 months old age and 6-12 months old age respectively), in different seasons (48, 43, 31, 53 faecal samples were collected in summer, autumn, winter andspring respectively)and from different Governorates [El sharkia (54), El dakahlya (49) and Kafrelsheikh (72)].
II- Isolation of C. perfringens: each sample was inoculated onto a tube of sterile freshly prepared cooked meat medium (CMM) then the tube was incubated anaerobically at 37°C for 24-48 hours after that a loopful from the previously incubated tube was streaked onto the surface of 10% sheep blood agar with neomycin sulphate (200 µg /ml) and the plate was incubated anaerobically at 37°C for 24-48 hours (Smith and Holdeman, 1968).
III- Identification of the isolates: it based mainly on:
1- Colonial appearance: This included size of the colony, elevation edges, structure and haemolytic activity (Vaikosen and Muller, 2001).
2- Microscopical appearance: prepared smearsfromsuspected colonies were stained with Gram`s stain and examined microscopically (Wilson and Miles, 1975).
3- Biochemical tests: suspected purified isolates were obtained and identified according to the schemes of (Koneman et al., 1992) forfermentation of sugars, gelatin liquefaction, litmus milk, catalase, indole tests.
4- Nagler’s test by half antitoxin plate as described by (Smith and Holdeman, 1968).
5- Typing of C. perfringens toxins by dermonecrotic test in albino guinea pigs: itwas applied by preparation of the toxins and their treatment (Bullen, 1952), application of dermonecrotic test I/D of an albino guinea pig (Quinn et al., 2002) and interpretation of the results according to colour degree of the dermonecrotic reaction and its neutralization (Stern and Batty, 1975).
6- Toxin antitoxin neutralization test: it was performed by injection of the toxin antitoxin mixture intraperitoneally in mice or intradermally in an albino guinea pig (Smith and Holdeman, 1968).
7- PCR for genotyping of C. perfringens:
A- Extraction of C.perfringens DNA (Sheedy et al., 2004):
Pure colonies of C. perfringens were grown over night in 5 ml brain heart infusion supplemented with 1% sodium thioglycolate at 37°C under anaerobic condition. 1 ml of culture was centrifuged at 5000 xg for 15 minutes; the cell pellet was washed twice with 1 ml phosphate buffer saline (PH 7.2) then resuspended in 50µl PBS. The mixture was vortexed, heated directly at 100°C for 10 minutes in a heat block for cell lysis then cooled on refrigerator for 5 minutes. Finally the suspension was centrifuged at 13,000 xg for 2 minutes. 10 µl of supernatant fluid was used as template DNA.
B- Primer selection:
1- For conventional PCR: oligonucleotide primers were selected using primer 3 software (free soft ware tool from the internet) and confirmed by Blast software from gene bank using mega blast program.
Alpha toxin (cpa) gene:
5` AAG ATT TGT AAG GCG CTT 3`
5` ATT TCC TGA AAT CCA CTC 3`
Epsilon toxin (etx) gene:
5'AAG TTT AGC AAT CGC ATC 3'
5' TAT TCC TGG TGC CTT AAT 3'
2- for multiplex PCR (Augustynowicz et al., 2000):
| cpa gene | 5`GTT GAT AGC GCA GGA CAT GTT AAG 3` 5` CAT GTA GTC ATC TGT TCC AGC ATC 3` |
| cpb gene | 5`ACTATACAGACAGATCATTCAACC 3` 5`TTAGGAGCAGTTAGAACTACAGAC 3` |
| etx gene | 5` ACT GCA ACT ACT ACT CAT ACT GTG 3` 5` CTG GTG CCT TAA TAG AAA GAC TCC 3` |
| cpi gene | 5`GCGATGAAAAGCCTACACCACTAC 3` 5`GGTATATCCTCCACGCATATAGTC 3 |
C- PCR amplification and cycling protocol:
1- For conventional PCR(Yamogishi et al., 1997 and Tong and Labbe, 2003):
DNA samples were amplified in a total of 25 μl of the following reaction mixture: 5µl 10X buffer, 1µl MgCl2, 1µl dNTPs, 0.5µl Taq polymerase enzyme, 0.25µl of each primers, 12µl DNase-RNase- free deionized water and 5µl of template DNA. PCR cycling program was performed in Ptc-100 Peltier thermal cycler according to C.perfringens toxin genes as following: initial denaturation at 94°C for 5 minutes then 35 cycles consisting of (denaturation at 94°C for 1 minute, annealing at 53°C for 1 minute and extension at 72°C for 1 minute) for alpha toxin gene while for epsilon toxin gene: initial denaturation at 93°C for 7 minutes then 30 cycles consisting of (denaturation at 95°C for 30 seconds, annealing at 57°C for 30 seconds and extension at 73°C for 1 minute) thus followed by final extension at 72°C for 5 minutes.
2- For multiplex PCR (Augustynowicz et al., 2000):
DNA samples were amplified in a total of 50 μl of the following reaction mixture: 5µl 10X buffer, 1.5µl MgCl2, 4µl dNTPs, 1µl Taq polymerase, 0.5µl of each primers, 5µl template DNA and completed to 50 µl by DNase-RNase-free deionized water. PCR cycling program was performed in PROGENE thermal cycler as following: initial denaturation at 94°C for 3 minutes then 30 cycles consisting of (denaturation at 94°C for 1 minute, annealing at 55°C for 1 minute and extension at 72°C for 1 minute) thus followed by final extension at 72°C for 5 minutes.
D- Detection of PCR products (Augustynowicz et al., 2000):
5 µl of each amplicon was mixed with sample buffer and applied on agarose gel 1.5% (w/v) containing 0.5 µg of ethidium bromide. The samples were electrophoresed at 80 V for 1 hour on a mini horizontal electrophoresis unit (BIO-RAD, USA). A 100 bp DNA ladder was used as a molecular weight standard (Pharmacia). After electrophoresis, the gel was visualized and photographed. Image analysis was done by Image QuantTL-V2003.03 (Amersham Biosciences).
8-Sodium dodecyl sulphate polyacrylamide gel electrophoresis (Oconnor, 2006):
Propagated C. perfringens isolates in CMM were centrifuged at 2500 xg for 30 minutes in a cooling centrifuge (4°C). The formed pellet was washed two or three times in PBS (pH 7.2). An equal volume of lysozyme 0.1% was added to the pellet for cell lysis then incubation at 37°C for 30-60 minutes. an equal volume of lysis buffer (50mM Tris-HCl [pH 6.8], 10% SDS, 50% glycerol, 2% β-mercaptoethanol, 0.1% bromophenol blue) was added to cellular pellet then boiling at 100°C for 5 minutes in a water bath. Lysed samples were centrifuged at 11.600 rcf for 10 minutes to remove cell debris. Supernatant containing the soluble whole cell membrane proteins was stored at – 4°C until used. Estimation of the protein concentration was determined (Bradford, 1976). The proteins were separated on 10% acrylamide gels by adjusting the current to provide 1.5 mA per lane for 4-5 hours in a Hoefer SE 400 vertical electrophoresis unit (Hoefer Scientific Instrument, San Francisco, California, USA). Gels were stained with Coomassie brilliant blue. SDS-PAGE molecular weight standard was used as a marker (Pharmacia). Gel documentation was done by Image QuantTL-V2003.03 (Amersham Biosciences).
RESULTS
I- Incidence of C. perfringens in diarrhoeic calves: incidence of C.perfringens in diarrhoeic calves in different ages, seasons and Governorates as in tables (1, 2, 3) respectively.
II- Identification of C. perfringens isolates:
1- Colonial appearance: on neomycin sulphate sheep blood agar, C. perfringens colonies were 2-3 mm in diameter, rounded, raised, domed, glistening, non spreading with entire margins and beaten surfaces and showed double zones of haemolysis.
2- Microscopical examination: C.perfringens is Gram positive short plumb bacilli, about 3-7 µm in length and 0.4-1.2 µm in thickness rarely has central or subterminal oval non bulging endospores.
3- Biochemical tests: C.perfringens is fermentative to different sugars as glucose, maltose, lactose, sucrose and mannose with production of acid and gases, gelatin liquefiers, litmus milk positive, catalase, oxidase and indole tests negative
4- Nagler`s test by half antitoxin plate: on egg yolk agar medium, the attack of C. perfringens alpha toxin on lecithin gave opalescence on the side of the plate without antitoxin while this was inhibited on the other side of the plate with antitoxin.
5- Typing of C. perfringens recovered from diarrhoeic calves: it was applied by dermonecrotic test in albino guinea pigs. The isolated strains from diarrhoeic calves were types A, D and non toxigenic. Action of C.perfringens type "A" (alpha toxin) appeared as an irregular area of yellowish necrosis tended to spread downward while that of type "D" (epsilon toxin) appeared as a circular white necrosis with few small areas of purplish haemorrhagic appearance. Typing of C. perfringens isolates recovered from diarrhoeic calves in relation to different ages, seasons and Governorates as shown in tables (4, 5, 6) respectively.
6- Toxin antitoxin neutralization test: It was applied by injection of each C. perfringens toxin with its specific antitoxin intradermally on the skin of albino guinea pigs or intraperitoneally in white Swiss mice. The results showed protection of the injected laboratory animals because of neutralization of each toxin with its specific antitoxin.
7- PCR for genotyping of C.perfringens:
a- Conventional PCR results: revealed that C.perfringens alpha toxin gene gave 1167 bp fragment (Photo 1) while C. perfringens epsilon toxin gene gave 960 bp fragment (Photo 2).
b- Multiplex PCR results: showed that all the examined field isolates were identified as C.perfringens type "A" (alpha toxin) and gave a characteristic band at 402 bp (Photo 3).
8- SDS-PAGE of C. perfringens type A whole membrane proteins: revealed that field isolates of C.perfringens type A whole membrane proteins gave 9 –12 protein bands with molecular weights ranged from 4.47 – 129.39 kDa (photo 4). All field isolates shared common antigenic bands at 128.76, 113.83, 39.80, 29.95, 27.15 and 6.31 kDa. There was one specific antigenic band at 90.13, 77.71, 48.95 and 21.99 kDa.
Table (1): Incidence of C.perfringens in diarrhoeic calves in different ages
| Governorate Age | El-sharkia | El-dakahlya | Kafrelsheikh | T. Ex. No. | T. Is. No. | % | ||||||
| Ex. No. | Is. No. | % | Ex. No. | Is. No. | % | Ex. No. | Is. No. | % | ||||
| Newborn calves | 12 | 7 | 58.33% | 18 | 16 | 88.9% | 12 | 5 | 41.67% | 42 | 28 | 66.67% |
| 1-6 month old age | 22 | 12 | 54.55% | |||||||||
Views: 43 views
Report this Article
| Comments (0) |